Updating workflows/epigenetics/chipseq-sr from 1.1 to 1.2 by gxydevbot · Pull Request #1225 · galaxyproject/iwc

gxydevbot · 2026-04-27T07:45:52Z

Hello! This is an automated update of the following workflow: workflows/epigenetics/chipseq-sr. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/1.3.1+galaxy0 should be updated to toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/1.3.2+galaxy0

The workflow release number has been updated from 1.1 to 1.2.

If you want to skip this change, close this PR without deleting the branch. It will be reopened if another change is detected.
Any commit from another author than 'planemo-autoupdate' will prevent more auto-updates.
To ignore manual changes and allow autoupdates, delete the branch.

gxydevbot · 2026-05-04T07:42:31Z

There are new updates, they have been integrated to the PR, check the file diff.

gxydevbot · 2026-05-25T09:26:34Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2026-05-25T09:42:45Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ chipseq-sr.ga_0

Problems:

Output with path /tmp/tmpl5pcvq18/MultiQC on dataset 8, 12, and 21 and collection 5, 10, and 15 Stats__571efc98-3ac2-4767-983d-4f6d03dabca8.tabular different than expected
Expected line 'Sample	macs2-d	macs2-treatment_redundant_rate	macs2-peak_count	bowtie_2_hisat2-overall_alignment_rate	fastp-after_filtering_q30_rate	fastp-after_filtering_q30_bases	fastp-filtering_result_passed_filter_reads	fastp-after_filtering_gc_content	fastp-pct_surviving	fastp-pct_adapter	fastp-before_filtering_read1_mean_length' in output ('Sample	macs2-d	macs2-treatment_redundant_rate	macs2-peak_count	bowtie_2_hisat2-overall_alignment_rate	fastp-after_filtering_q30_rate	fastp-after_filtering_q30_bases	fastp-filtering_result_passed_filter_reads	fastp-after_filtering_gc_content	fastp-pct_surviving_reads	fastp-pct_surviving_bases	fastp-pct_adapter	fastp-before_filtering_read1_mean_length
wt_H3K4me3	200.0	0.0	9	98.27	93.5014	2.374989	0.049812999999999996	57.69879999999999	99.626	99.61007843137256	0.122	51.0
')

Workflow invocation details

Invocation Messages

Steps

Step 1: SR fastq input:
- step_state: scheduled
Step 2: Adapter sequence:
- step_state: scheduled
Step 3: Percentage of bad quality bases per read:
- step_state: scheduled
Step 4: Reference genome:
- step_state: scheduled
Step 5: Effective genome size:
- step_state: scheduled
Step 6: Normalize profile:
- step_state: scheduled

Step 7: Fastp (remove adapter and bad quality reads) (toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/1.3.3+galaxy0):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/fastp:1.3.3--h43da1c4_0

Command Line:

ln -sf '/tmp/tmpdwgygvtf/files/6/2/b/dataset_62bbf6ca-7372-49bc-bce0-e6457f4143d3.dat' 'wt_H3K4me3.fastqsanger.gz' &&   fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'wt_H3K4me3.fastqsanger.gz'  -i 'wt_H3K4me3.fastqsanger.gz'   -o first.fastqsanger.gz     --adapter_sequence 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'                  -q 30 -u 70              --dont_eval_duplication                  && mv first.fastqsanger.gz '/tmp/tmpdwgygvtf/job_working_directory/000/2/outputs/dataset_1d962c70-87d5-44c2-81d3-7b8444a14c63.dat'

Exit Code:

```
0
```

Standard Error:

Read1 before filtering:
total reads: 50000
total bases: 2550000
Q20 bases: 2486726(97.5187%)
Q30 bases: 2377575(93.2382%)
Q40 bases: 936574(36.7284%)

Read1 after filtering:
total reads: 49813
total bases: 2540057
Q20 bases: 2482579(97.7371%)
Q30 bases: 2374989(93.5014%)
Q40 bases: 936420(36.8661%)

Filtering result:
reads passed filter: 49813
reads failed due to low quality: 187
reads failed due to too many N: 0
reads failed due to too short: 0
reads failed due to adapter dimer: 0
reads with adapter trimmed: 61
bases trimmed due to adapters: 406

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title wt_H3K4me3.fastqsanger.gz -i wt_H3K4me3.fastqsanger.gz -o first.fastqsanger.gz --adapter_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -q 30 -u 70 --dont_eval_duplication 
fastp v1.3.3, time used: 0 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7e50b522581d11f190a10022488dc0a5"`
chromInfo	`"/tmp/tmpdwgygvtf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
duplicated_reads	`{"handling_options": {"__current_case__": 0, "eval_dups": "--dont_eval_duplication"}}`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": "30", "unqualified_percent_limit": "70"}}`
output_options	`{"report_html": true, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_front_select": {"__current_case__": 1, "cut_front": ""}, "cut_right_select": {"__current_case__": 1, "cut_right": ""}, "cut_tail_select": {"__current_case__": 1, "cut_tail": ""}}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": null, "umi_prefix": null}}
single_paired	`{"__current_case__": 0, "adapter_trimming_options": {"adapter_sequence1": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_tail1": null}, "in1": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "single"}`

Step 8: Bowtie2 map on reference (toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.5+galaxy0):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/mulled-v2-c742dccc9d8fabfcff2af0d8d6799dbc711366cf:0b0dea2b5dffed0cff6fb77b4377a5940cd4319a-0

Command Line:

set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmpdwgygvtf/files/1/d/9/dataset_1d962c70-87d5-44c2-81d3-7b8444a14c63.dat' input_f.fastq.gz &&   THREADS=${GALAXY_SLOTS:-4} && if [ "$THREADS" -gt 1 ]; then (( THREADS-- )); fi &&   bowtie2  -p "$THREADS"  -x '/cvmfs/data.galaxyproject.org/byhand/mm10/bowtie2_index/mm10'   -U 'input_f.fastq.gz'                 2> >(tee '/tmp/tmpdwgygvtf/job_working_directory/000/3/outputs/dataset_41da46ce-244b-41dd-b5dd-22a8e57ac508.dat' >&2)  | samtools sort -l 0 -T "${TMPDIR:-.}" -O bam | samtools view --no-PG -O bam -@ ${GALAXY_SLOTS:-1} -o '/tmp/tmpdwgygvtf/job_working_directory/000/3/outputs/dataset_92dd4fb4-1d20-401c-a273-20d996865974.dat'

Exit Code:

```
0
```

Standard Error:

[WARNING] Failed to launch x86-64-v3 version, staying with default
[WARNING] Failed to launch x86-64-v3 version, staying with default
49813 reads; of these:
  49813 (100.00%) were unpaired; of these:
    863 (1.73%) aligned 0 times
    44357 (89.05%) aligned exactly 1 time
    4593 (9.22%) aligned >1 times
98.27% overall alignment rate

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"7e50b522581d11f190a10022488dc0a5"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "no_presets"}`
chromInfo	`"/tmp/tmpdwgygvtf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 0, "aligned_file": false, "input_1": {"values": [{"id": 2, "src": "dce"}]}, "type": "single", "unaligned_file": false}`
reference_genome	`{"__current_case__": 0, "index": "mm10", "source": "indexed"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 9: filter MAPQ30 (toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/samtools:1.8--h46bd0b3_5

Command Line:

ln -s '/tmp/tmpdwgygvtf/files/9/2/d/dataset_92dd4fb4-1d20-401c-a273-20d996865974.dat' input.bam && ln -s '/tmp/tmpdwgygvtf/files/_metadata_files/f/b/b/metadata_fbba2a27-454c-4dd3-ab3a-43b1e4672269.dat' input.bai && samtools view -o '/tmp/tmpdwgygvtf/job_working_directory/000/4/outputs/dataset_1f01a4ff-0b05-4ad5-b762-c9ebc949c0aa.dat' -h   -b  -q 30 input.bam

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"7e50b522581d11f190a10022488dc0a5"`
bed_file	`None`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
dbkey	`"mm10"`
flag	`{"__current_case__": 0, "filter": "no"}`
header	`"-h"`
library	`""`
mapq	`"30"`
outputtype	`"bam"`
possibly_select_inverse	`false`
read_group	`""`
regions	`""`

Step 10: Call Peaks with MACS2 (toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/mulled-v2-d35d986df816cc29c117288b7cd6a8b3edf56ec6:61f17e2b6111cff7569855769bf86a92f2df23a5-0

Command Line:

export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmpdwgygvtf/files/1/f/0/dataset_1f01a4ff-0b05-4ad5-b762-c9ebc949c0aa.dat'  --name wt_H3K4me3    --format BAM   --gsize '1870000000'      --SPMR     --call-summits  --keep-dup '1'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --nomodel --extsize '200' --shift '0'  2>&1 > macs2_stderr) && cp wt_H3K4me3_peaks.xls '/tmp/tmpdwgygvtf/job_working_directory/000/5/outputs/dataset_c370e04a-eee6-491a-b915-96ca1981239e.dat'   && ( count=`ls -1 wt_H3K4me3* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmpdwgygvtf/job_working_directory/000/5/outputs/dataset_d84e5af1-a846-4952-8aa1-2fd89bad2307_files' && cp -r wt_H3K4me3* '/tmp/tmpdwgygvtf/job_working_directory/000/5/outputs/dataset_d84e5af1-a846-4952-8aa1-2fd89bad2307_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmpdwgygvtf/job_working_directory/000/5/outputs/dataset_d84e5af1-a846-4952-8aa1-2fd89bad2307_files' macs2_stderr > '/tmp/tmpdwgygvtf/job_working_directory/000/5/outputs/dataset_d84e5af1-a846-4952-8aa1-2fd89bad2307.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)

Exit Code:

```
0
```

Standard Output:

INFO  @ Mon, 25 May 2026 09:40:26: 
# Command line: callpeak -t /tmp/tmpdwgygvtf/files/1/f/0/dataset_1f01a4ff-0b05-4ad5-b762-c9ebc949c0aa.dat --name wt_H3K4me3 --format BAM --gsize 1870000000 --SPMR --call-summits --keep-dup 1 --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift 0
# ARGUMENTS LIST:
# name = wt_H3K4me3
# format = BAM
# ChIP-seq file = ['/tmp/tmpdwgygvtf/files/1/f/0/dataset_1f01a4ff-0b05-4ad5-b762-c9ebc949c0aa.dat']
# control file = None
# effective genome size = 1.87e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is off
# Searching for subpeak summits is on
# MACS will save fragment pileup signal per million reads
 
INFO  @ Mon, 25 May 2026 09:40:26: #1 read tag files... 
INFO  @ Mon, 25 May 2026 09:40:26: #1 read treatment tags... 
INFO  @ Mon, 25 May 2026 09:40:26: 44568 reads have been read. 
INFO  @ Mon, 25 May 2026 09:40:26: #1 tag size is determined as 51 bps 
INFO  @ Mon, 25 May 2026 09:40:26: #1 tag size = 51.0 
INFO  @ Mon, 25 May 2026 09:40:26: #1  total tags in treatment: 44568 
INFO  @ Mon, 25 May 2026 09:40:26: #1 user defined the maximum tags... 
INFO  @ Mon, 25 May 2026 09:40:26: #1 filter out redundant tags at the same location and the same strand by allowing at most 1 tag(s) 
INFO  @ Mon, 25 May 2026 09:40:26: #1  tags after filtering in treatment: 44528 
INFO  @ Mon, 25 May 2026 09:40:26: #1  Redundant rate of treatment: 0.00 
INFO  @ Mon, 25 May 2026 09:40:26: #1 finished! 
INFO  @ Mon, 25 May 2026 09:40:26: #2 Build Peak Model... 
INFO  @ Mon, 25 May 2026 09:40:26: #2 Skipped... 
INFO  @ Mon, 25 May 2026 09:40:26: #2 Use 200 as fragment length 
INFO  @ Mon, 25 May 2026 09:40:26: #3 Call peaks... 
INFO  @ Mon, 25 May 2026 09:40:26: #3 Going to call summits inside each peak ... 
INFO  @ Mon, 25 May 2026 09:40:26: #3 Pre-compute pvalue-qvalue table... 
INFO  @ Mon, 25 May 2026 09:40:26: #3 In the peak calling step, the following will be performed simultaneously: 
INFO  @ Mon, 25 May 2026 09:40:26: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... wt_H3K4me3_treat_pileup.bdg 
INFO  @ Mon, 25 May 2026 09:40:26: #3   Write bedGraph files for control lambda (after scaling if necessary)... wt_H3K4me3_control_lambda.bdg 
INFO  @ Mon, 25 May 2026 09:40:26: #3   --SPMR is requested, so pileup will be normalized by sequencing depth in million reads. 
INFO  @ Mon, 25 May 2026 09:40:26: #3 Call peaks for each chromosome... 
INFO  @ Mon, 25 May 2026 09:40:26: #4 Write output xls file... wt_H3K4me3_peaks.xls 
INFO  @ Mon, 25 May 2026 09:40:26: #4 Write peak in narrowPeak format file... wt_H3K4me3_peaks.narrowPeak 
INFO  @ Mon, 25 May 2026 09:40:26: #4 Write summits bed file... wt_H3K4me3_summits.bed 
INFO  @ Mon, 25 May 2026 09:40:26: Done!

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7e50b522581d11f190a10022488dc0a5"`
advanced_options	`{"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 1, "keep_dup_options_selector": "1"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": true, "to_large": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
control	`{"__current_case__": 1, "c_select": "No"}`
cutoff_options	`{"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"}`
dbkey	`"mm10"`
effective_genome_size_options	`{"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "1870000000"}`
format	`"BAM"`
nomodel_type	`{"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "0"}`
outputs	`["peaks_tabular", "summits", "bdg", "html"]`
treatment	`{"__current_case__": 0, "input_treatment_file": {"values": [{"id": 7, "src": "dce"}]}, "t_multi_select": "No"}`

Step 11: summary of MACS2 (toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy3):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/mulled-v2-a8b1e1ec4fafcddd7d4c96fdaa021e5b6c1e8a67:df94bf9d9805780191d934cd829fe22b0fb68df2-0

Command Line:

grep -P -A 0 -B 0 --no-group-separator  -i -- '^#' '/tmp/tmpdwgygvtf/files/c/3/7/dataset_c370e04a-eee6-491a-b915-96ca1981239e.dat' > '/tmp/tmpdwgygvtf/job_working_directory/000/6/outputs/dataset_28969339-4c3e-426a-807e-df9a824830e8.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7e50b522581d11f190a10022488dc0a5"`
case_sensitive	`"-i"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
color	`"NOCOLOR"`
dbkey	`"mm10"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-P"`
url_paste	`"^#"`

Step 12: Bigwig from MACS2 (wig_to_bigWig):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/ucsc-wigtobigwig:357--h446ed27_4

Command Line:

grep -v "^track" '/tmp/tmpdwgygvtf/files/9/e/f/dataset_9ef3301c-6c17-4268-a59a-c0bb247b54b8.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len' '/tmp/tmpdwgygvtf/job_working_directory/000/7/outputs/dataset_65a0e781-ebac-4006-a954-4adebba9f435.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"7e50b522581d11f190a10022488dc0a5"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
dbkey	`"mm10"`
settings	`{"__current_case__": 0, "settingsType": "preset"}`

Step 13: MultiQC (toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.35+galaxy0):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/multiqc:1.35--pyhdfd78af_1

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/fastp_0 &&         grep -Pq '"before_filtering": {' /tmp/tmpdwgygvtf/files/0/3/a/dataset_03a28bc5-d083-4f32-a635-c80560643816.dat || die "Module 'fastp: '"before_filtering": {' not found in the file 'wt_H3K4me3'" && ln -s '/tmp/tmpdwgygvtf/files/0/3/a/dataset_03a28bc5-d083-4f32-a635-c80560643816.dat' 'multiqc_WDir/fastp_0/wt_H3K4me3.json'  &&    mkdir multiqc_WDir/bowtie2_1 &&         grep -Pq '% overall alignment rate' /tmp/tmpdwgygvtf/files/4/1/d/dataset_41da46ce-244b-41dd-b5dd-22a8e57ac508.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'wt_H3K4me3'" && ln -s '/tmp/tmpdwgygvtf/files/4/1/d/dataset_41da46ce-244b-41dd-b5dd-22a8e57ac508.dat' 'multiqc_WDir/bowtie2_1/wt_H3K4me3'  &&    mkdir multiqc_WDir/macs2_2 &&        grep -Pq '# This file is generated by MACS' /tmp/tmpdwgygvtf/files/c/3/7/dataset_c370e04a-eee6-491a-b915-96ca1981239e.dat || die "Module 'macs2: '# This file is generated by MACS' not found in the file 'wt_H3K4me3'" && ln -s '/tmp/tmpdwgygvtf/files/c/3/7/dataset_c370e04a-eee6-491a-b915-96ca1981239e.dat' 'multiqc_WDir/macs2_2/wt_H3K4me3_peaks.xls'  &&       multiqc multiqc_WDir --filename 'report'    --export   && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.35

       file_search | Search path: /tmp/tmpdwgygvtf/job_working_directory/000/8/working/multiqc_WDir
             macs2 | Found 1 logs
           bowtie2 | Found 1 reports
             fastp | Found 1 reports
     write_results | Rendering plots. Export plots to formats png, svg, pdf is requested, so it might take a while. To disable plot export, set `export_plots: false` in config, or remove the `--export-plots` command line flag
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '77,175,74' to RGB: input #77,175,74 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '77,175,74' to RGB: input #77,175,74 is not in #RRGGBB format
        mqc_colour | Error converting color '77,175,74' to RGB: input #77,175,74 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
     write_results | Data        : report_data
     write_results | Report      : report.html
     write_results | Plots       : report_plots
           multiqc | MultiQC complete

Standard Output:

total 488
-rw-r--r-- 1 1001 1001     88 May 25 09:41 bowtie2_se_plot.txt
-rw-r--r-- 1 1001 1001   1069 May 25 09:41 fastp-seq-content-gc-plot_Read_1_After_filtering.txt
-rw-r--r-- 1 1001 1001   1048 May 25 09:41 fastp-seq-content-gc-plot_Read_1_Before_filtering.txt
-rw-r--r-- 1 1001 1001    723 May 25 09:41 fastp-seq-content-n-plot_Read_1_After_filtering.txt
-rw-r--r-- 1 1001 1001    703 May 25 09:41 fastp-seq-content-n-plot_Read_1_Before_filtering.txt
-rw-r--r-- 1 1001 1001    858 May 25 09:41 fastp-seq-quality-plot_Read_1_After_filtering.txt
-rw-r--r-- 1 1001 1001    863 May 25 09:41 fastp-seq-quality-plot_Read_1_Before_filtering.txt
-rw-r--r-- 1 1001 1001    119 May 25 09:41 fastp_filtered_reads_plot.txt
-rw-r--r-- 1 1001 1001   8089 May 25 09:41 llms-full.txt
-rw-r--r-- 1 1001 1001  23053 May 25 09:41 multiqc.log
-rw-r--r-- 1 1001 1001  35827 May 25 09:41 multiqc.parquet
-rw-r--r-- 1 1001 1001    167 May 25 09:41 multiqc_bowtie2.txt
-rw-r--r-- 1 1001 1001    422 May 25 09:41 multiqc_citations.txt
-rw-r--r-- 1 1001 1001 327081 May 25 09:41 multiqc_data.json
-rw-r--r-- 1 1001 1001  42237 May 25 09:41 multiqc_fastp.txt
-rw-r--r-- 1 1001 1001    473 May 25 09:41 multiqc_general_stats.txt
-rw-r--r-- 1 1001 1001    194 May 25 09:41 multiqc_macs.txt
-rw-r--r-- 1 1001 1001     47 May 25 09:41 multiqc_software_versions.txt
-rw-r--r-- 1 1001 1001    408 May 25 09:41 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"7e50b522581d11f190a10022488dc0a5"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
comment	`""`
dbkey	`"mm10"`
export	`true`
flat	`false`
image_content_input	`None`
png_plots	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 8, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 4, "input": {"values": [{"id": 6, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 17, "input": {"values": [{"id": 8, "src": "hdca"}]}, "software": "macs2"}}]`
title	`""`

Other invocation details
- history_id
  - ba5bdc0c883f426c
- history_state
  - ok
- invocation_id
  - ba5bdc0c883f426c
- invocation_state
  - scheduled
- workflow_id
  - ba5bdc0c883f426c

gxydevbot · 2026-06-01T10:37:55Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2026-06-01T10:59:16Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ chipseq-sr.ga_0

Problems:

Output with path /tmp/tmppl_yozbi/MultiQC on dataset 8, 12, and 21 and collection 5, 10, and 15 Stats__356eef78-f4f9-44c6-903d-2f2dfc60d764.tabular different than expected
Expected line 'Sample	macs2-d	macs2-treatment_redundant_rate	macs2-peak_count	bowtie_2_hisat2-overall_alignment_rate	fastp-after_filtering_q30_rate	fastp-after_filtering_q30_bases	fastp-filtering_result_passed_filter_reads	fastp-after_filtering_gc_content	fastp-pct_surviving	fastp-pct_adapter	fastp-before_filtering_read1_mean_length' in output ('Sample	macs2-d	macs2-treatment_redundant_rate	macs2-peak_count	bowtie_2_hisat2-overall_alignment_rate	fastp-after_filtering_q30_rate	fastp-after_filtering_q30_bases	fastp-filtering_result_passed_filter_reads	fastp-after_filtering_gc_content	fastp-pct_surviving_reads	fastp-pct_surviving_bases	fastp-pct_adapter	fastp-before_filtering_read1_mean_length
wt_H3K4me3	200.0	0.0	9	98.27	93.5014	2.374989	0.049812999999999996	57.69879999999999	99.626	99.61007843137256	0.122	51.0
')

Workflow invocation details

Invocation Messages

Steps

Step 1: SR fastq input:
- step_state: scheduled
Step 2: Adapter sequence:
- step_state: scheduled
Step 3: Percentage of bad quality bases per read:
- step_state: scheduled
Step 4: Reference genome:
- step_state: scheduled
Step 5: Effective genome size:
- step_state: scheduled
Step 6: Normalize profile:
- step_state: scheduled

Step 7: Fastp (remove adapter and bad quality reads) (toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/1.3.3+galaxy0):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/fastp:1.3.3--h43da1c4_0

Command Line:

ln -sf '/tmp/tmp418xk7y3/files/f/a/6/dataset_fa6b0d22-8ba5-425a-8510-879be8c697e4.dat' 'wt_H3K4me3.fastqsanger.gz' &&   fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'wt_H3K4me3.fastqsanger.gz'  -i 'wt_H3K4me3.fastqsanger.gz'   -o first.fastqsanger.gz     --adapter_sequence 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'                  -q 30 -u 70              --dont_eval_duplication                  && mv first.fastqsanger.gz '/tmp/tmp418xk7y3/job_working_directory/000/2/outputs/dataset_d59b0354-69c1-43fc-b831-3ce29308aede.dat'

Exit Code:

```
0
```

Standard Error:

Read1 before filtering:
total reads: 50000
total bases: 2550000
Q20 bases: 2486726(97.5187%)
Q30 bases: 2377575(93.2382%)
Q40 bases: 936574(36.7284%)

Read1 after filtering:
total reads: 49813
total bases: 2540057
Q20 bases: 2482579(97.7371%)
Q30 bases: 2374989(93.5014%)
Q40 bases: 936420(36.8661%)

Filtering result:
reads passed filter: 49813
reads failed due to low quality: 187
reads failed due to too many N: 0
reads failed due to too short: 0
reads failed due to adapter dimer: 0
reads with adapter trimmed: 61
bases trimmed due to adapters: 406

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title wt_H3K4me3.fastqsanger.gz -i wt_H3K4me3.fastqsanger.gz -o first.fastqsanger.gz --adapter_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -q 30 -u 70 --dont_eval_duplication 
fastp v1.3.3, time used: 0 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"221b467e5da811f19fe17c1e527c0ba7"`
chromInfo	`"/tmp/tmp418xk7y3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
duplicated_reads	`{"handling_options": {"__current_case__": 0, "eval_dups": "--dont_eval_duplication"}}`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": "30", "unqualified_percent_limit": "70"}}`
output_options	`{"report_html": true, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_front_select": {"__current_case__": 1, "cut_front": ""}, "cut_right_select": {"__current_case__": 1, "cut_right": ""}, "cut_tail_select": {"__current_case__": 1, "cut_tail": ""}}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": null, "umi_prefix": null}}
single_paired	`{"__current_case__": 0, "adapter_trimming_options": {"adapter_sequence1": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_tail1": null}, "in1": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "single"}`

Step 8: Bowtie2 map on reference (toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.5+galaxy0):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/mulled-v2-c742dccc9d8fabfcff2af0d8d6799dbc711366cf:0b0dea2b5dffed0cff6fb77b4377a5940cd4319a-0

Command Line:

set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmp418xk7y3/files/d/5/9/dataset_d59b0354-69c1-43fc-b831-3ce29308aede.dat' input_f.fastq.gz &&   THREADS=${GALAXY_SLOTS:-4} && if [ "$THREADS" -gt 1 ]; then (( THREADS-- )); fi &&   bowtie2  -p "$THREADS"  -x '/cvmfs/data.galaxyproject.org/byhand/mm10/bowtie2_index/mm10'   -U 'input_f.fastq.gz'                 2> >(tee '/tmp/tmp418xk7y3/job_working_directory/000/3/outputs/dataset_6761e815-d7b4-467b-b946-766d75c034be.dat' >&2)  | samtools sort -l 0 -T "${TMPDIR:-.}" -O bam | samtools view --no-PG -O bam -@ ${GALAXY_SLOTS:-1} -o '/tmp/tmp418xk7y3/job_working_directory/000/3/outputs/dataset_459c0da1-ca8c-4ee4-932a-b93767da7646.dat'

Exit Code:

```
0
```

Standard Error:

[WARNING] Failed to launch x86-64-v3 version, staying with default
[WARNING] Failed to launch x86-64-v3 version, staying with default
49813 reads; of these:
  49813 (100.00%) were unpaired; of these:
    863 (1.73%) aligned 0 times
    44357 (89.05%) aligned exactly 1 time
    4593 (9.22%) aligned >1 times
98.27% overall alignment rate

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"221b467e5da811f19fe17c1e527c0ba7"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "no_presets"}`
chromInfo	`"/tmp/tmp418xk7y3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 0, "aligned_file": false, "input_1": {"values": [{"id": 2, "src": "dce"}]}, "type": "single", "unaligned_file": false}`
reference_genome	`{"__current_case__": 0, "index": "mm10", "source": "indexed"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 9: filter MAPQ30 (toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/samtools:1.8--h46bd0b3_5

Command Line:

ln -s '/tmp/tmp418xk7y3/files/4/5/9/dataset_459c0da1-ca8c-4ee4-932a-b93767da7646.dat' input.bam && ln -s '/tmp/tmp418xk7y3/files/_metadata_files/c/8/9/metadata_c891bc98-95fc-4f63-aa85-b4a6c01e0d8f.dat' input.bai && samtools view -o '/tmp/tmp418xk7y3/job_working_directory/000/4/outputs/dataset_71d8b73d-fdb9-4099-bacf-813dc2b41884.dat' -h   -b  -q 30 input.bam

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"221b467e5da811f19fe17c1e527c0ba7"`
bed_file	`None`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
dbkey	`"mm10"`
flag	`{"__current_case__": 0, "filter": "no"}`
header	`"-h"`
library	`""`
mapq	`"30"`
outputtype	`"bam"`
possibly_select_inverse	`false`
read_group	`""`
regions	`""`

Step 10: Call Peaks with MACS2 (toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/mulled-v2-d35d986df816cc29c117288b7cd6a8b3edf56ec6:61f17e2b6111cff7569855769bf86a92f2df23a5-0

Command Line:

export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmp418xk7y3/files/7/1/d/dataset_71d8b73d-fdb9-4099-bacf-813dc2b41884.dat'  --name wt_H3K4me3    --format BAM   --gsize '1870000000'      --SPMR     --call-summits  --keep-dup '1'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --nomodel --extsize '200' --shift '0'  2>&1 > macs2_stderr) && cp wt_H3K4me3_peaks.xls '/tmp/tmp418xk7y3/job_working_directory/000/5/outputs/dataset_6290cf73-808c-49c5-ab9b-7e602ba7caeb.dat'   && ( count=`ls -1 wt_H3K4me3* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmp418xk7y3/job_working_directory/000/5/outputs/dataset_0c295d92-c618-4055-b809-78a8d8adb7bc_files' && cp -r wt_H3K4me3* '/tmp/tmp418xk7y3/job_working_directory/000/5/outputs/dataset_0c295d92-c618-4055-b809-78a8d8adb7bc_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmp418xk7y3/job_working_directory/000/5/outputs/dataset_0c295d92-c618-4055-b809-78a8d8adb7bc_files' macs2_stderr > '/tmp/tmp418xk7y3/job_working_directory/000/5/outputs/dataset_0c295d92-c618-4055-b809-78a8d8adb7bc.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)

Exit Code:

```
0
```

Standard Output:

INFO  @ Mon, 01 Jun 2026 10:56:50: 
# Command line: callpeak -t /tmp/tmp418xk7y3/files/7/1/d/dataset_71d8b73d-fdb9-4099-bacf-813dc2b41884.dat --name wt_H3K4me3 --format BAM --gsize 1870000000 --SPMR --call-summits --keep-dup 1 --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift 0
# ARGUMENTS LIST:
# name = wt_H3K4me3
# format = BAM
# ChIP-seq file = ['/tmp/tmp418xk7y3/files/7/1/d/dataset_71d8b73d-fdb9-4099-bacf-813dc2b41884.dat']
# control file = None
# effective genome size = 1.87e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is off
# Searching for subpeak summits is on
# MACS will save fragment pileup signal per million reads
 
INFO  @ Mon, 01 Jun 2026 10:56:50: #1 read tag files... 
INFO  @ Mon, 01 Jun 2026 10:56:50: #1 read treatment tags... 
INFO  @ Mon, 01 Jun 2026 10:56:50: 44568 reads have been read. 
INFO  @ Mon, 01 Jun 2026 10:56:50: #1 tag size is determined as 51 bps 
INFO  @ Mon, 01 Jun 2026 10:56:50: #1 tag size = 51.0 
INFO  @ Mon, 01 Jun 2026 10:56:50: #1  total tags in treatment: 44568 
INFO  @ Mon, 01 Jun 2026 10:56:50: #1 user defined the maximum tags... 
INFO  @ Mon, 01 Jun 2026 10:56:50: #1 filter out redundant tags at the same location and the same strand by allowing at most 1 tag(s) 
INFO  @ Mon, 01 Jun 2026 10:56:50: #1  tags after filtering in treatment: 44528 
INFO  @ Mon, 01 Jun 2026 10:56:50: #1  Redundant rate of treatment: 0.00 
INFO  @ Mon, 01 Jun 2026 10:56:50: #1 finished! 
INFO  @ Mon, 01 Jun 2026 10:56:50: #2 Build Peak Model... 
INFO  @ Mon, 01 Jun 2026 10:56:50: #2 Skipped... 
INFO  @ Mon, 01 Jun 2026 10:56:50: #2 Use 200 as fragment length 
INFO  @ Mon, 01 Jun 2026 10:56:50: #3 Call peaks... 
INFO  @ Mon, 01 Jun 2026 10:56:50: #3 Going to call summits inside each peak ... 
INFO  @ Mon, 01 Jun 2026 10:56:50: #3 Pre-compute pvalue-qvalue table... 
INFO  @ Mon, 01 Jun 2026 10:56:50: #3 In the peak calling step, the following will be performed simultaneously: 
INFO  @ Mon, 01 Jun 2026 10:56:50: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... wt_H3K4me3_treat_pileup.bdg 
INFO  @ Mon, 01 Jun 2026 10:56:50: #3   Write bedGraph files for control lambda (after scaling if necessary)... wt_H3K4me3_control_lambda.bdg 
INFO  @ Mon, 01 Jun 2026 10:56:50: #3   --SPMR is requested, so pileup will be normalized by sequencing depth in million reads. 
INFO  @ Mon, 01 Jun 2026 10:56:50: #3 Call peaks for each chromosome... 
INFO  @ Mon, 01 Jun 2026 10:56:50: #4 Write output xls file... wt_H3K4me3_peaks.xls 
INFO  @ Mon, 01 Jun 2026 10:56:50: #4 Write peak in narrowPeak format file... wt_H3K4me3_peaks.narrowPeak 
INFO  @ Mon, 01 Jun 2026 10:56:50: #4 Write summits bed file... wt_H3K4me3_summits.bed 
INFO  @ Mon, 01 Jun 2026 10:56:50: Done!

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"221b467e5da811f19fe17c1e527c0ba7"`
advanced_options	`{"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 1, "keep_dup_options_selector": "1"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": true, "to_large": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
control	`{"__current_case__": 1, "c_select": "No"}`
cutoff_options	`{"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"}`
dbkey	`"mm10"`
effective_genome_size_options	`{"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "1870000000"}`
format	`"BAM"`
nomodel_type	`{"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "0"}`
outputs	`["peaks_tabular", "summits", "bdg", "html"]`
treatment	`{"__current_case__": 0, "input_treatment_file": {"values": [{"id": 7, "src": "dce"}]}, "t_multi_select": "No"}`

Step 11: summary of MACS2 (toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy3):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/mulled-v2-a8b1e1ec4fafcddd7d4c96fdaa021e5b6c1e8a67:df94bf9d9805780191d934cd829fe22b0fb68df2-0

Command Line:

grep -P -A 0 -B 0 --no-group-separator  -i -- '^#' '/tmp/tmp418xk7y3/files/6/2/9/dataset_6290cf73-808c-49c5-ab9b-7e602ba7caeb.dat' > '/tmp/tmp418xk7y3/job_working_directory/000/6/outputs/dataset_46014b94-db88-4d21-a6d9-9f1e916107f2.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"221b467e5da811f19fe17c1e527c0ba7"`
case_sensitive	`"-i"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
color	`"NOCOLOR"`
dbkey	`"mm10"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-P"`
url_paste	`"^#"`

Step 12: Bigwig from MACS2 (wig_to_bigWig):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/ucsc-wigtobigwig:357--h446ed27_4

Command Line:

grep -v "^track" '/tmp/tmp418xk7y3/files/2/2/c/dataset_22cf3faf-e511-4bbc-9485-899a00ad4d60.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len' '/tmp/tmp418xk7y3/job_working_directory/000/7/outputs/dataset_cc6f5c7f-4de7-4094-9fad-3492c9744be4.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"221b467e5da811f19fe17c1e527c0ba7"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
dbkey	`"mm10"`
settings	`{"__current_case__": 0, "settingsType": "preset"}`

Step 13: MultiQC (toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.35+galaxy1):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Container:

quay.io/biocontainers/multiqc:1.35--pyhdfd78af_1

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/fastp_0 &&         grep -Pq '"before_filtering": {' /tmp/tmp418xk7y3/files/4/b/9/dataset_4b9d0962-0312-4c3b-b5ea-32ea6d415e51.dat || die "Module 'fastp: '"before_filtering": {' not found in the file 'wt_H3K4me3'" && ln -s '/tmp/tmp418xk7y3/files/4/b/9/dataset_4b9d0962-0312-4c3b-b5ea-32ea6d415e51.dat' 'multiqc_WDir/fastp_0/wt_H3K4me3.json'  &&    mkdir multiqc_WDir/bowtie2_1 &&         grep -Pq '% overall alignment rate' /tmp/tmp418xk7y3/files/6/7/6/dataset_6761e815-d7b4-467b-b946-766d75c034be.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'wt_H3K4me3'" && ln -s '/tmp/tmp418xk7y3/files/6/7/6/dataset_6761e815-d7b4-467b-b946-766d75c034be.dat' 'multiqc_WDir/bowtie2_1/wt_H3K4me3'  &&    mkdir multiqc_WDir/macs2_2 &&        grep -Pq '# This file is generated by MACS' /tmp/tmp418xk7y3/files/6/2/9/dataset_6290cf73-808c-49c5-ab9b-7e602ba7caeb.dat || die "Module 'macs2: '# This file is generated by MACS' not found in the file 'wt_H3K4me3'" && ln -s '/tmp/tmp418xk7y3/files/6/2/9/dataset_6290cf73-808c-49c5-ab9b-7e602ba7caeb.dat' 'multiqc_WDir/macs2_2/wt_H3K4me3_peaks.xls'  &&       multiqc multiqc_WDir --filename 'report'    --export   && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.35

       file_search | Search path: /tmp/tmp418xk7y3/job_working_directory/000/8/working/multiqc_WDir
             macs2 | Found 1 logs
           bowtie2 | Found 1 reports
             fastp | Found 1 reports
     write_results | Rendering plots. Export plots to formats png, svg, pdf is requested, so it might take a while. To disable plot export, set `export_plots: false` in config, or remove the `--export-plots` command line flag
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '77,175,74' to RGB: input #77,175,74 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '55,126,184' to RGB: input #55,126,184 is not in #RRGGBB format
        mqc_colour | Error converting color '77,175,74' to RGB: input #77,175,74 is not in #RRGGBB format
        mqc_colour | Error converting color '77,175,74' to RGB: input #77,175,74 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
        mqc_colour | Error converting color '152,78,163' to RGB: input #152,78,163 is not in #RRGGBB format
     write_results | Data        : report_data
     write_results | Report      : report.html
     write_results | Plots       : report_plots
           multiqc | MultiQC complete

Standard Output:

total 488
-rw-r--r-- 1 1001 1001     88 Jun  1 10:57 bowtie2_se_plot.txt
-rw-r--r-- 1 1001 1001   1069 Jun  1 10:57 fastp-seq-content-gc-plot_Read_1_After_filtering.txt
-rw-r--r-- 1 1001 1001   1048 Jun  1 10:57 fastp-seq-content-gc-plot_Read_1_Before_filtering.txt
-rw-r--r-- 1 1001 1001    723 Jun  1 10:57 fastp-seq-content-n-plot_Read_1_After_filtering.txt
-rw-r--r-- 1 1001 1001    703 Jun  1 10:57 fastp-seq-content-n-plot_Read_1_Before_filtering.txt
-rw-r--r-- 1 1001 1001    858 Jun  1 10:57 fastp-seq-quality-plot_Read_1_After_filtering.txt
-rw-r--r-- 1 1001 1001    863 Jun  1 10:57 fastp-seq-quality-plot_Read_1_Before_filtering.txt
-rw-r--r-- 1 1001 1001    119 Jun  1 10:57 fastp_filtered_reads_plot.txt
-rw-r--r-- 1 1001 1001   8089 Jun  1 10:57 llms-full.txt
-rw-r--r-- 1 1001 1001  23053 Jun  1 10:57 multiqc.log
-rw-r--r-- 1 1001 1001  35826 Jun  1 10:57 multiqc.parquet
-rw-r--r-- 1 1001 1001    167 Jun  1 10:57 multiqc_bowtie2.txt
-rw-r--r-- 1 1001 1001    422 Jun  1 10:57 multiqc_citations.txt
-rw-r--r-- 1 1001 1001 327081 Jun  1 10:57 multiqc_data.json
-rw-r--r-- 1 1001 1001  42237 Jun  1 10:57 multiqc_fastp.txt
-rw-r--r-- 1 1001 1001    473 Jun  1 10:57 multiqc_general_stats.txt
-rw-r--r-- 1 1001 1001    194 Jun  1 10:57 multiqc_macs.txt
-rw-r--r-- 1 1001 1001     47 Jun  1 10:57 multiqc_software_versions.txt
-rw-r--r-- 1 1001 1001    408 Jun  1 10:57 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"221b467e5da811f19fe17c1e527c0ba7"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
comment	`""`
dbkey	`"mm10"`
export	`true`
flat	`false`
image_content_input	`None`
png_plots	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 8, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 4, "input": {"values": [{"id": 6, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 17, "input": {"values": [{"id": 8, "src": "hdca"}]}, "software": "macs2"}}]`
title	`""`

Other invocation details
- history_id
  - f903895db074a184
- history_state
  - ok
- invocation_id
  - f903895db074a184
- invocation_state
  - scheduled
- workflow_id
  - f903895db074a184

gxydevbot changed the title ~~Updating workflows/epigenetics/chipseq-sr from 1.1 to 1.2~~ Updating workflows/epigenetics/chipseq-sr from 1.1 to 1.2 May 4, 2026

gxydevbot force-pushed the workflows/epigenetics/chipseq-sr branch from 66ac768 to 2561ba5 Compare May 4, 2026 07:42

gxydevbot force-pushed the workflows/epigenetics/chipseq-sr branch from 2561ba5 to 382094d Compare May 25, 2026 09:26

Updating workflows/epigenetics/chipseq-sr from 1.1 to 1.2

044bf38

gxydevbot force-pushed the workflows/epigenetics/chipseq-sr branch from 382094d to 044bf38 Compare June 1, 2026 10:37

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Updating workflows/epigenetics/chipseq-sr from 1.1 to 1.2 #1225

Updating workflows/epigenetics/chipseq-sr from 1.1 to 1.2 #1225
gxydevbot wants to merge 1 commit into
galaxyproject:mainfrom
planemo-autoupdate:workflows/epigenetics/chipseq-sr

gxydevbot commented Apr 27, 2026

Uh oh!

gxydevbot commented May 4, 2026

Uh oh!

gxydevbot commented May 25, 2026

Uh oh!

github-actions Bot commented May 25, 2026

Workflow invocation details

Uh oh!

gxydevbot commented Jun 1, 2026

Uh oh!

github-actions Bot commented Jun 1, 2026

Workflow invocation details

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

1 participant

Conversation

gxydevbot commented Apr 27, 2026

Uh oh!

gxydevbot commented May 4, 2026

Uh oh!

gxydevbot commented May 25, 2026

Uh oh!

github-actions Bot commented May 25, 2026

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

Uh oh!

gxydevbot commented Jun 1, 2026

Uh oh!

github-actions Bot commented Jun 1, 2026

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

1 participant